View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3628_low_48 (Length: 236)
Name: NF3628_low_48
Description: NF3628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3628_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 220
Target Start/End: Complemental strand, 37582243 - 37582051
Alignment:
| Q |
28 |
cttctttgtattaaagattggtcattgacttaataatcttctggtttataattatataaaaatgtgagtaatctatttttatgtgaagcgaactactcac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37582243 |
cttctttgtattaaagattggtcattgacttaataatcttctggtttataattatataaaaatgtgagtaatctatttttatgtgaagcgaactactcac |
37582144 |
T |
|
| Q |
128 |
actgttattatttcttagcagcaaatgtgatccaaaaccaagaaagtcacgttcagttgttaccgtaatttaaattatgttgatacctctttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37582143 |
actgttattatttcttagcagcaaatgtgatccaaaaccaagaaagtcacgttcagttgttaccgtaatttaaattatgttgatacctctttt |
37582051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University