View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_high_16 (Length: 366)
Name: NF3629_high_16
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 20 - 277
Target Start/End: Original strand, 40765267 - 40765530
Alignment:
| Q |
20 |
tgaatgaaacctgttatcggagagatagatttcagataagatctggaaacggcgtcgtcgaagatcggacggttgctgagagttcaagagccaccgtcga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40765267 |
tgaatgaaacctgttatcggagagatagatttcagatcagatctggaaatggcgtcgtcgaagatcggacggtggctgagagttcaagagccaccgtcga |
40765366 |
T |
 |
| Q |
120 |
gatctcagttga---gtcgtcgtcgtgcnnnnnnnnnnnnnnntg----agtgaaacttgtttcggacacaaagcagaacaaaactcgcggcaataaact |
212 |
Q |
| |
|
|||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40765367 |
gatctcagttgagtcgtcgtcgtcgtgcgagagagagagagagtgtgtgagtgaaacttgtttcggacacaaagcagaacaaaactcgcggcaat-aact |
40765465 |
T |
 |
| Q |
213 |
tacaacctctagtcgtggtagtaacagtaaactataaaagtaaactactctaatttagatgaaaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40765466 |
tacaacctctagtcgtggtagtaacagtaaactataaaagtaaactactctaatttagatgaaaa |
40765530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 305 - 361
Target Start/End: Original strand, 40765557 - 40765613
Alignment:
| Q |
305 |
gttacaatacttaccattttatttaaataattaacaaatctataaattcatatcact |
361 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40765557 |
gttacaatacttatcattttatttaaataattaacatatctataaattcatatcact |
40765613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University