View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_high_17 (Length: 362)
Name: NF3629_high_17
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 28760543 - 28760432
Alignment:
| Q |
2 |
cgtctttaaaattcgaaagaaaactcgcttcagttttcactgcacctcatgaagatgatcatggaaactagagtgtgaccaatgagttagggttagggtt |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28760543 |
cgtctttaaaattagaaagaaaactcgcttcagttttcactgcacctcatgaagatgatcatggaaactagagtgtgaccaatgagttagggttagggtt |
28760444 |
T |
|
| Q |
102 |
tcaaactcaact |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28760443 |
tcaaactcaact |
28760432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 185 - 345
Target Start/End: Complemental strand, 28760354 - 28760194
Alignment:
| Q |
185 |
atataaattccgatgatactgcagaagaacacaatttaattacgtcataataatctgaatcggttttgagtgaaattacaattcnnnnnnnnnnnnnnnn |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28760354 |
atataaattccgatgatactgcagaagaacacaattcaattacgtcataataatctgaatcggttttgagtgaaattacaattcttttttatattttttt |
28760255 |
T |
|
| Q |
285 |
nnnnnnnnatatgaaatgtcttattttggaataataataatgaactttcttgtccattttt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28760254 |
ggttttttatatgaaatgtcttattttggaataataataatgaactttcttgtccattttt |
28760194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University