View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_high_33 (Length: 236)
Name: NF3629_high_33
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 36542692 - 36542481
Alignment:
| Q |
1 |
tagaaaaataaatggagtgccatatgtatggagatttcatnnnnnnntatatctttgtattnnnnnnnntacaaataatgtgtaattaaatgttgtagat |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
36542692 |
tagaaaaataaatggagtgtcatatgtatggagattttataaaaaaatatatctttgtattaaaa----tacaaataatgtgtaatttaatgttttagat |
36542597 |
T |
|
| Q |
101 |
tatacgtctgagttatgtgttgttggaagttatgcacaaaataaaataagtttgaatcttgagtcatgcacacatttattagtgggtttcatttttatgg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36542596 |
tatacgtc-gagttatgtgttgttggaagttatgcacaaaataaaataagtttgaatcttgagtcatgcacacatttattagtgggtttcatttttatgg |
36542498 |
T |
|
| Q |
201 |
aaattatatgggaaaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36542497 |
aaattatatgggaaaaa |
36542481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University