View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_high_34 (Length: 226)
Name: NF3629_high_34
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 10404142 - 10404337
Alignment:
| Q |
7 |
aaaatattgagcaagatgataagggtgaagaggtagtgaatgttgtagaaattagccatggatgtgttgaattttgagagcagtcactactatatttata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10404142 |
aaaatattgagcaagatgataagggtgaagaggtagtgaatgttgtagaaattagccatggatgtgttgaattttgagagcagtcactactatatttata |
10404241 |
T |
 |
| Q |
107 |
tatccataaccataacctagttcataatactttttgataatctaaatagggttcttttatggtaccaacttaaaaaatagggattggtctcgatat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10404242 |
tatccataaccataacctagttcataatactttttgataatctaaatagggttctttcatggtaccaacttaaaaaatagggattggtctcgatat |
10404337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University