View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_high_35 (Length: 219)
Name: NF3629_high_35
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_high_35 |
 |  |
|
| [»] scaffold0232 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 36 - 205
Target Start/End: Original strand, 42392222 - 42392392
Alignment:
| Q |
36 |
ttggttttttctgaaacagtttaagaaaccaaaccataaattggatatggtttggtttggtttatgaaccatgcacactcctagttataacaacttaaca |
135 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392222 |
ttggttttttctgaaacaggttaagaaaccaaaccataaattgaatatggtttggtttgatttatgaaccatgcacactcctagttataacaacttaaca |
42392321 |
T |
 |
| Q |
136 |
agaagtatatccattaggtcactcaacacc-tggtatgaacctctttcccgcaacactactaacaatacac |
205 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42392322 |
agaagtataaccattacgtcactcaacaccttggtatgaacctctttcccgcaacactgctaacaatacac |
42392392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 85 - 118
Target Start/End: Original strand, 4010590 - 4010623
Alignment:
| Q |
85 |
gtttggtttggtttatgaaccatgcacactccta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
4010590 |
gtttggtttggtttatgaaccatgcacaccccta |
4010623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0232 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0232
Description:
Target: scaffold0232; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 83 - 112
Target Start/End: Complemental strand, 21452 - 21423
Alignment:
| Q |
83 |
tggtttggtttggtttatgaaccatgcaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21452 |
tggtttggtttggtttatgaaccatgcaca |
21423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 85 - 126
Target Start/End: Complemental strand, 7528163 - 7528122
Alignment:
| Q |
85 |
gtttggtttggtttatgaaccatgcacactcctagttataac |
126 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
7528163 |
gtttggtttggttcatgaatcatgcacacccctagttataac |
7528122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University