View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_15 (Length: 388)
Name: NF3629_low_15
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 19 - 387
Target Start/End: Complemental strand, 8851739 - 8851371
Alignment:
| Q |
19 |
aggtatacatgatcagtgttgtcaaagaatgtctatcccgacggtatagtgcattattttcgggatagcgcatcgtattgtgaagaaatcgctattattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8851739 |
aggtatacatgatcagtgttgtcaaagaatgtctatcccgacggtatagcgcattatattcgggatagcgcatcgtattgtgaagaaatcgctgttattt |
8851640 |
T |
 |
| Q |
119 |
tgtgatccgcatatttagtacaagccattattttttgcgatccgcgattgataacactgttcatgataggtgtcactttcagnnnnnnncaatctactta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8851639 |
tgtgatccgcatatttagtacaagccattattttttgcgatccgcgattgataacactgttcatgataggtgtcactttcagtttttttcaatctactta |
8851540 |
T |
 |
| Q |
219 |
ttaaattttttccctttggtctttgaaaatgtattatttactttcgaatacaatgtcttctggaactcttttgcctaatatcatgaattaacctttttgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851539 |
ttaaattttttccctttggtctttgaaaatgtattatttactttcgaatacaatgtcttctggaactcttttgcctaatatcatgaattaacctttttgt |
8851440 |
T |
 |
| Q |
319 |
agttctgcataggtaccagaaaagatgattttttggttgtaatcaacgaccctgcattgtatcatggcc |
387 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8851439 |
agttctgcataggtaccataaaagatgattttttggttgtaatcaacgaccctgcattgtatcatggcc |
8851371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 313 - 374
Target Start/End: Original strand, 38524242 - 38524303
Alignment:
| Q |
313 |
ttttgtagttctgcataggtaccagaaaagatgattttttggttgtaatcaacgaccctgca |
374 |
Q |
| |
|
||||| |||||||||||||||||| ||||| ||||| |||| ||| ||||||||||||||| |
|
|
| T |
38524242 |
ttttgcagttctgcataggtaccattaaagacgatttcttgggtgtgatcaacgaccctgca |
38524303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University