View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_21 (Length: 331)
Name: NF3629_low_21
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 21 - 280
Target Start/End: Original strand, 39079615 - 39079866
Alignment:
| Q |
21 |
tcaatgctaaaaaacgtttatagaggtggttaccgatcatccaccaaagaagtcctgacatttataacaaaagttaaattcacagagaggtaaatcaatc |
120 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| | || |||||||||| |
|
|
| T |
39079615 |
tcaatgctaaaatacgtttatagaggtggttaccgatcatccactaaagaggtcctgacatttataacagaagttaaattcacaaacagataaatcaatc |
39079714 |
T |
 |
| Q |
121 |
tcttatcgaccgagctaaccttcattactcttgagatgcacttatatcttgttgcgtctaaaaatcacaaaagtataatatgataaaaagagnnnnnnnn |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||| || | |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39079715 |
tcttatcgaccgagctagccttcattact-----tataaagttatatcttgttgcatctaaaaatcacaaaagtataatatgataaaaagag---aaaaa |
39079806 |
T |
 |
| Q |
221 |
ngtctttctctcaagttatgggtggtcttaaatttatttagaatactacaattttcgatc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39079807 |
agtctttctctcaagttatgggtggtcttaaatttgtttagaatactacaattttcgatc |
39079866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University