View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_22 (Length: 328)
Name: NF3629_low_22
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_22 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 20 - 328
Target Start/End: Complemental strand, 43099880 - 43099572
Alignment:
| Q |
20 |
attctatcaagcaccagcaaccaccttcacatatgaagaagaacccccggctgttgtaagatccttcctctgcggcttcatctctgtcatgacggccatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43099880 |
attctatcaagcaccagcaaccaccttcacatatgaagaagaacccccggctgttgtaagatccttcctctgcggcttcatctctgtcatgaccgccatc |
43099781 |
T |
|
| Q |
120 |
gtagctctcttcggcttaatctccttgatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099780 |
gtagctctcttcggcttaatctccttgatcggctattttgttctcaaaccccgtatccctgagttcagtgtcaattcagcttcacttacctcattcaatt |
43099681 |
T |
|
| Q |
220 |
tgaccggctccggtctcaatgcaaaatgggacatcacactcattgtctcacaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099680 |
tgaccggctccggtctcaatgcaaaatgggacatcacactcattgtctcaaaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgt |
43099581 |
T |
|
| Q |
320 |
cttttacgg |
328 |
Q |
| |
|
||||||||| |
|
|
| T |
43099580 |
cttttacgg |
43099572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 234 - 328
Target Start/End: Complemental strand, 43106880 - 43106786
Alignment:
| Q |
234 |
ctcaatgcaaaatgggacatcacactcattgtctcacaccctaacaaaaaactcgatatcacatacgacgccgttgctgccagtgtcttttacgg |
328 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||| ||||||||||||||||||| ||||| ||| |||||||| ||| ||||||||||||| |
|
|
| T |
43106880 |
ctcactgcaaaatgggacatcacattcattgcctcaaaccctaacaaaaaactcgacatcacctacaacgccgtttctgttggtgtcttttacgg |
43106786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University