View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_24 (Length: 304)
Name: NF3629_low_24
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 56020203 - 56019917
Alignment:
| Q |
18 |
tctcccatatctgaatcaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaata |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56020203 |
tctcccatatctgaatgaaccgagagaatttatgcataaggttgaccctcttttgcaaggacacttccccaaccgaggtctgcgtcgtctgcttttaata |
56020104 |
T |
 |
| Q |
118 |
attgatatgtgtctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56020103 |
attgatatgtgtctccgggagaatccaagagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtct |
56020004 |
T |
 |
| Q |
218 |
ataaacatggggtgcgtagctaaccgttgcaaccacatttcaaaccagacagaagttaatttacataggtataagattctaggttgt |
304 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
56020003 |
ataaacatgggttgcgcagctaaccgttgcaaccacatttcaaaccagacagaagttaatatacttaggtataagattctaggttgt |
56019917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University