View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_28 (Length: 250)
Name: NF3629_low_28
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 31902929 - 31902696
Alignment:
| Q |
11 |
cagagaacagttcaatcaactctggtagacttggatgatcatgatcctaagtcctcaaacatcaagcttaaattgatggctataggtagcatgtgttggc |
110 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31902929 |
cagagaacagttccatcacccctggtagacttggatgatc------ctaagtcctcaaacatcaagcataaattgatggctatagttagcatgtgttggc |
31902836 |
T |
|
| Q |
111 |
ttgattagaatgacgttttgtgctgcttaccatttacctatgattggcttttttatttggtgtatggtattctcgttcgagttgatcgatttaattgcgt |
210 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||| |
|
|
| T |
31902835 |
ttgattagaatgacattttgtgttgcttaccatttacctatgattggcttttttatttggtgtatgatattctcggtcgagttgatcgatttaattacgt |
31902736 |
T |
|
| Q |
211 |
aggaaacacataattaatggagagattggtccttgcaacc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31902735 |
aggaaacacataattaatggagagattggtccttgcaacc |
31902696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University