View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3629_low_5 (Length: 505)
Name: NF3629_low_5
Description: NF3629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3629_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 6e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 360 - 492
Target Start/End: Complemental strand, 32372162 - 32372030
Alignment:
| Q |
360 |
tagaacaaagcagaacatgaatttgattctgggattcatgatgttttgttcaattaaccatgctgtttttattcccacaaaaagaacaaactttttctta |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32372162 |
tagaacaaagcagaacatgaatttgattctgggattcatgatgttttgttcaattaaccatgctgtttttattcccacaaaaagaacaaactttttctta |
32372063 |
T |
|
| Q |
460 |
ccaattacacaatttcatggtgcaattcagttc |
492 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32372062 |
ccaattacacaatttcatggtgcaattcagttc |
32372030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 32372532 - 32372407
Alignment:
| Q |
1 |
tgatggaagccctaaatccccaattggggattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggagaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32372532 |
tgatggaagccctaaatccccaattgggaattcaactgctgaagagaaaactgttcagaagagtcctgagcctgaaaatgctgaatttggggtgaatgct |
32372433 |
T |
|
| Q |
101 |
gaggaggatgctgagaggtgggtatttcg |
129 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
32372432 |
g---aggatgctgagaggtgggtatttcg |
32372407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University