View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3630_low_14 (Length: 232)
Name: NF3630_low_14
Description: NF3630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3630_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 44838917 - 44838718
Alignment:
| Q |
20 |
cttttataattgctggctaacgactgcaatgnnnnnnncaatgacaaaatcaccatccatcagcattacgtattccttataaatttcattttattataag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838917 |
cttttataattgctggctaacgactgcaatgaaaaaaacaatgacaaaatcaccatccatcagcattacgtattccttataaatttcattttattataag |
44838818 |
T |
 |
| Q |
120 |
ttttccaccttga---gtaagtacttgtactctccttcatatttttctagataacacattgtcttctacttgcattaaaatcactgaaacctttcttcat |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838817 |
ttttccaccttgatcagtaagtacttgtactctccttcatatttttctagataacacattgtcttctacttgcattaaaatcactgaaacctttcttcat |
44838718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University