View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3630_low_9 (Length: 327)
Name: NF3630_low_9
Description: NF3630
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3630_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 24 - 310
Target Start/End: Complemental strand, 54075543 - 54075257
Alignment:
| Q |
24 |
gcttccattatcatacaatatgaaattttccactcccacttttgaatgatacacaacccattccctcaaaaacttcgccacattataaaccatcgtgcat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075543 |
gcttccattatcatacaatatgaaattttccactcccacttttgaatgatacacaacccattccctcaaaaacttcgccacattataaaccatcgtgcat |
54075444 |
T |
 |
| Q |
124 |
gcacaaaggaaatatttgggctgggccggaggcccaaacttttgaacagccacgggcttagaattgggtttattgggcctgggagtgtaatacgctacgg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075443 |
gcacaaaggaaatatttgggctgggccggaggcccaaagttttgaactgccacgggcttagaattgggtttattgggcctgggagtgtaatacgctacgg |
54075344 |
T |
 |
| Q |
224 |
acggaaccacgatgttttctccaataatctcgagggaaacaccaattttggaattcgaacccaaatcagacggatctggatgcaagc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54075343 |
acggaaccacgatgttttctccaataatctcgagggaaactccaatttcggaattcgaacccaaatcagacggatctggatgcaagc |
54075257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University