View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3632_low_18 (Length: 236)

Name: NF3632_low_18
Description: NF3632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3632_low_18
NF3632_low_18
[»] chr4 (1 HSPs)
chr4 (19-236)||(27693656-27693873)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 27693873 - 27693656
Alignment:
19 atccggaagactattgggatatatcttcggagaggtgtggtggtgaggaaaagcaatactattcttattttgttaacggacgtgaagacgtgagtaacat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27693873 atccggaagactattgggatatatcttcggagaggtgtggtggtgaggaaaagcaatactattcttattttgttaacggacgtgaagacgtgagtaacat 27693774  T
119 agtagagtcatgcagagtggagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtcgttatccagatgtatacagg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
27693773 agtagagtcatgcagagtggagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtggttatccagatgtatacagg 27693674  T
219 gagtatgtcaacggaatt 236  Q
    ||||||||||||||||||    
27693673 gagtatgtcaacggaatt 27693656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University