View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3632_low_18 (Length: 236)
Name: NF3632_low_18
Description: NF3632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3632_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 27693873 - 27693656
Alignment:
| Q |
19 |
atccggaagactattgggatatatcttcggagaggtgtggtggtgaggaaaagcaatactattcttattttgttaacggacgtgaagacgtgagtaacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693873 |
atccggaagactattgggatatatcttcggagaggtgtggtggtgaggaaaagcaatactattcttattttgttaacggacgtgaagacgtgagtaacat |
27693774 |
T |
 |
| Q |
119 |
agtagagtcatgcagagtggagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtcgttatccagatgtatacagg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27693773 |
agtagagtcatgcagagtggagatgaaggtaattatgagtagctgggatggaaagctgaaatgtaatagcagcaagtgtggttatccagatgtatacagg |
27693674 |
T |
 |
| Q |
219 |
gagtatgtcaacggaatt |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27693673 |
gagtatgtcaacggaatt |
27693656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University