View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3632_low_7 (Length: 339)
Name: NF3632_low_7
Description: NF3632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3632_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 329
Target Start/End: Complemental strand, 37062677 - 37062366
Alignment:
| Q |
18 |
attttgacctatcaaccttatcaaacgccttaaaagacgtcatgcgcttcagctcctgagacacctgtctcagtttagccgaaagcgacgatggacgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062677 |
attttgacctatcaaccttatcaaacgccttaaaagacgtcatgcgcttcagctcctgagacacctgtctcagtttagccgaaagcgacgatggacgctt |
37062578 |
T |
|
| Q |
118 |
ctcaagctggcttgccagaaacgcggtttcagtgtctccaccgcgaatattctgaacggaaacggagtcatcacgtacgttcaatgttatctccaccatt |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062577 |
ctcaagctggcttgccagaaacgccgtttcagtgtctccaccgcgaatattctgaacggaaacggagtcatcacgtacgttcaatgttatctccaccatt |
37062478 |
T |
|
| Q |
218 |
tcaccatcgtccttgaagcttgcacttttgttcttgcttcggtttcgttgttttttggatgctaaaggcccactgaggcccacccctgagcttcggcttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062477 |
tcaccatcgtccttgaagcttgcacttttgttcttgcttcggtttcgttgttttttggatgctaaaggcccactgaggcccacccctgagcttcggcttc |
37062378 |
T |
|
| Q |
318 |
cggtgctctctg |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37062377 |
cggtgctctctg |
37062366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University