View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3633_high_16 (Length: 234)
Name: NF3633_high_16
Description: NF3633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3633_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 12829274 - 12829492
Alignment:
| Q |
1 |
caagttgtagagattgtaccgcagtgagaaaattcttcaaagagaaaaagctgaaattcgttgaaatcaacgtcgacgtgtttcgtgaacgagagaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829274 |
caagttgtagagattgtaccgcagtgagaaaattcttcaaagagaaaaagctgaaattcgttgaaatcaacgtcgacgtgtttcgtgaacgagagaagga |
12829373 |
T |
 |
| Q |
101 |
gctacgtcaaagaacgggaacggtttcggtgccgatgattttcttcaacgagaagctaataggaggattagtagctttaaattcgcttcgaaatagcggc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12829374 |
gctacgtgaaagaacgggaacggtttcggtgccgatgattttcttcaacgagaagctaataggaggattagtagcgttaaattcgcttcgaaatagcggc |
12829473 |
T |
 |
| Q |
201 |
gaatttgaacggaggttga |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12829474 |
gaatttgaacggaggttga |
12829492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 13019702 - 13019739
Alignment:
| Q |
135 |
atgattttcttcaacgagaagctaataggaggattagt |
172 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
13019702 |
atgattttcttcaacgacaagctaatcggaggattagt |
13019739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University