View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3633_high_18 (Length: 230)
Name: NF3633_high_18
Description: NF3633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3633_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 12473326 - 12473525
Alignment:
| Q |
14 |
cataggttgttttgataaattaggatttatgtagtcaataatctatccatgcgctcgcagttaagaatgtctaaggtcgttggattgagatcggatccat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12473326 |
cataggttgttttgataaattaggatttatgtagtcaataatctatccatgcgctcgcagttaagaatgtctaaggtcgttggattgagattggatccat |
12473425 |
T |
 |
| Q |
114 |
atatatttttaaattgagcaatttatttcatattttcattacaatatgagcaggaggttgctcataatcagtcaaactggatcaaactggatccactact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12473426 |
atatatttttaaattgagcaatttatttcatattttcattacaatatgagcaggaggttgctcataatcagtcaaactggatcaaactggatccactact |
12473525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University