View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3633_low_14 (Length: 245)
Name: NF3633_low_14
Description: NF3633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3633_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 231
Target Start/End: Complemental strand, 12829056 - 12828830
Alignment:
| Q |
5 |
gacggagaagctagtcggagattcgttgtttttgttggtttgatatatctccggtggaactggcgatgggagaagggaatgaggatgatgaataaaccct |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
12829056 |
gacggataagctagtcggagattcgttgtttttgttggtttgatatatctccggtggaactggcgttgggagaagagaatgaggatgatgaataaaccct |
12828957 |
T |
 |
| Q |
105 |
tcgtttttgctatctacacctccttgttcataactaatttcgttgttagtaacggtttcgtggccgttagcgtgattttcgggtaagacgaaatgaagtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12828956 |
tcgtttttgctatctacacctccttgttcataactaatttcgttgttagtaacggtttcgtggccgttagcgtgattttcgggtaagacgaaatgaagtg |
12828857 |
T |
 |
| Q |
205 |
gattatttatgggttgaagttgaactg |
231 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
12828856 |
gaatatttatgggttgaagttgaactg |
12828830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University