View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3633_low_17 (Length: 233)
Name: NF3633_low_17
Description: NF3633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3633_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 219
Target Start/End: Original strand, 52964189 - 52964402
Alignment:
| Q |
6 |
aggagaagcataggaaaaggttcatagcacgtggggtcaatgtgcatctgtttgataacaatatttcagggaattaatcactcaatcatatttgaacacg |
105 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52964189 |
aggagcagcatgggaaaaagttcatagcacgtggggtcaatgtgtatctgtttgctaacaatatttcagggaattaatcactcaatcatatttgaacacg |
52964288 |
T |
 |
| Q |
106 |
tgtcaaaagttaaggattccaaccattcacgatccatctctgttttattataaattggcaacaatatggtgcccaaaatatataatacatcatgctatct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52964289 |
tgtcaaaagttaaggattccaaccattcacgatccatctctgttttattataaattggcaacaatatggtgcccaaaatatataatacatcatgctatct |
52964388 |
T |
 |
| Q |
206 |
agtgatgaaagatg |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52964389 |
agtgatgaaagatg |
52964402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 215
Target Start/End: Original strand, 53911745 - 53911810
Alignment:
| Q |
154 |
tataaattggcaacaatatggtgcccaaaatatata----atacatcatgctatctagtgatgaaa |
215 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
53911745 |
tataaattggcaacaatatgatgctcaaaatatataatacatacatcatgctatccagtgatgaaa |
53911810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University