View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3633_low_8 (Length: 303)
Name: NF3633_low_8
Description: NF3633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3633_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 43 - 295
Target Start/End: Complemental strand, 35318661 - 35318410
Alignment:
| Q |
43 |
gatctaattggagaagtatagcaccatctaaggtgcaaacccttaccaactcgagggaatctatagcaaagagggtgagtatttgtgatgggagggtcgt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35318661 |
gatctaattggagaagtatagcaccatctaaggtgcaaacccttaccaactcgagggaatctatagcaaagagggtgagtatttgtgatggtagggtcgt |
35318562 |
T |
|
| Q |
143 |
agattgtgtgtggtgtccagagattttggaggtggaggaccatttgttttgtatttataaatttttcggcttggtgtgataccttattttcaaatggatg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35318561 |
agattgtgtgtggtgtccagagattttggaggtggaggaccatttgttttgtatttataaattttccggcttgatgtgataccttattttcaaatggatg |
35318462 |
T |
|
| Q |
243 |
ggaaggggtgtgattttcccgggactattacctctcttttggacacctttgct |
295 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35318461 |
gg-aggggtgtgattttcccgggactattacctctcttttggacacctttgct |
35318410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University