View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_high_29 (Length: 241)
Name: NF3634_high_29
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_high_29 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 38107293 - 38107517
Alignment:
| Q |
17 |
caacttggtgattcatattgtgatgaatgtggtaactttgaagagagtattctacatgtgcttagagatttccttttggcggttaatgtttggaatcact |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38107293 |
caacttggtgattcatattgtgatcaatgtggtaactttgaagagagtattctacatgtgcttagagatttccttttggcggttaatgtttggaatcact |
38107392 |
T |
|
| Q |
117 |
tgacagaggtcaagcatatggaaagctttcttcctagctagctacaaagactggatttagttaaattttggtgagcatattggacatcgaaagagtgtca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38107393 |
tgacagaggtcaagcatatggaaagctttcttcctagctagctacaaagactggatttagttaaattttggtgagcatattggacatcgaaagagtgtca |
38107492 |
T |
|
| Q |
217 |
agtgggacactacgggcgacaactt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38107493 |
agtgggacactacgggcgacaactt |
38107517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University