View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3634_high_34 (Length: 231)

Name: NF3634_high_34
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3634_high_34
NF3634_high_34
[»] chr8 (1 HSPs)
chr8 (184-214)||(8540601-8540631)


Alignment Details
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 214
Target Start/End: Complemental strand, 8540631 - 8540601
Alignment:
184 caaagattaattagacataaatagaagacat 214  Q
    |||||||||||||||||||||||||||||||    
8540631 caaagattaattagacataaatagaagacat 8540601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University