View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_high_36 (Length: 226)
Name: NF3634_high_36
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_high_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 26159833 - 26160054
Alignment:
| Q |
5 |
caatttccaccttcttccgaattcgttggattggagtgtggaagccacgcagacccaaaatgacgaacatacccttatatgtttaaatgactaaattatc |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26159833 |
caatgtccaccttcttccgaattcgttggattggagtatggaagccacgcagacccaaaatgacgaacatacccttatatgtttaaatgactaaattatc |
26159932 |
T |
 |
| Q |
105 |
cttacatgtataaatctacagacaccattcattctcggccatttcgtaattaacaagcaatgggttccaaggcgatggcgatggcggcggagaagctaac |
204 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26159933 |
cttacaggtataaatatacagacaccattcattctcggccatttcgtaattaacaagcaatgggttccaaggcgatggcgatggcggcggagaagctaac |
26160032 |
T |
 |
| Q |
205 |
cacggcggtgcgacggcaagcc |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26160033 |
cacggcggtgcgacggcaagcc |
26160054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University