View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_low_20 (Length: 290)
Name: NF3634_low_20
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 163 - 281
Target Start/End: Complemental strand, 27010626 - 27010508
Alignment:
| Q |
163 |
ctaaataaatattgctcactctagatagtctagagtcaaaaattctaattagaatgtgttagaaaataaattccaatgttgcctaaattcacatccataa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27010626 |
ctaaataaatattgctcactctagatagtctagagtaaaaaatcttaattagaatgagtaagaaaataaattccaatgttgcctaaattcacatccataa |
27010527 |
T |
 |
| Q |
263 |
tatgtttccgaccctatga |
281 |
Q |
| |
|
|||||||| |||| ||||| |
|
|
| T |
27010526 |
tatgtttctgaccttatga |
27010508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 27010782 - 27010696
Alignment:
| Q |
7 |
atcatgacataaatctttccactaagacgatttaaacacacagacatcaaaatatatattatttacttacgtaaaaaatacacattg |
93 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27010782 |
atcatgacataaatctttccactaagaggatttaaacacacagacatcaaaatatatattatttacttacgtaaaaaatacacattg |
27010696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University