View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_low_32 (Length: 234)
Name: NF3634_low_32
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 6454451 - 6454314
Alignment:
| Q |
1 |
atttgttattcctttgggttcagaatcagaaatattagaaggaagacttatgtttaaagataggtctggttctaacaaaggtgaaaataaagtatgcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454451 |
atttgttattcctttgggttcagaatcagaaatattagaaggaagacttatgtttaaagataggtctggttctaacaaaggtgaaaataaagtatgcatt |
6454352 |
T |
|
| Q |
101 |
ttaggatgtgatttaattagggtatagtatagagtact |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454351 |
ttaggatgtgatttaattagggtatagtatagagtact |
6454314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 198 - 234
Target Start/End: Complemental strand, 6454254 - 6454218
Alignment:
| Q |
198 |
agtgattatatgatcatgagtgagtcatgatttgcat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454254 |
agtgattatatgatcatgagtgagtcatgatttgcat |
6454218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University