View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_low_34 (Length: 231)
Name: NF3634_low_34
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 184 - 214
Target Start/End: Complemental strand, 8540631 - 8540601
Alignment:
| Q |
184 |
caaagattaattagacataaatagaagacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8540631 |
caaagattaattagacataaatagaagacat |
8540601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University