View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3634_low_39 (Length: 222)
Name: NF3634_low_39
Description: NF3634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3634_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 1228097 - 1227907
Alignment:
| Q |
16 |
atatattaaattgttgttgtttattttattaataaaaaatgcaatgccttaaatgataagtttgagcttta-----gatatatctatctagacatgaaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1228097 |
atatattaaattgttgttgtttattttattaataaaaaatgcaatgccttaaatgataagtttgagctttaatttagatatatctatctagacatgaaca |
1227998 |
T |
 |
| Q |
111 |
tattttaaagtcacggaaataatctttttgcttatcaaatgtggatcaagatcttctctatttcttgaagaaatggaagatttcatttata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1227997 |
tattttaaagtcacggaaataatctttttgcttatcaaatgtggatcaagatcttctctatttcttgaagaaatggaagattacatttata |
1227907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University