View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3635_high_11 (Length: 227)
Name: NF3635_high_11
Description: NF3635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3635_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 7243179 - 7242989
Alignment:
| Q |
1 |
aattgacataagatgcctgtgcatgctgacacacactaatcactttcatgcgaactatctatatgtaacnnnnnnnnnnnnnccaagtaacaaagaagag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7243179 |
aattgacataagatgcctgtgcatgctgacacacactaatcactttcatgcgaactatctatatgtaactttttccttttt-ccaagtaacaaagaagag |
7243081 |
T |
 |
| Q |
101 |
agagtaggaagaagatgatggttcatcttaaagacttgctccattgtagaaagagcacaaaaatattcaatatgatgaggacctcaagttca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7243080 |
agagtaggaagaagatgatggttcatcttaaagacttgctccattgtagaaagagcacaaaaaaattcaatatgatgaggactccaagttca |
7242989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University