View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3635_low_8 (Length: 391)
Name: NF3635_low_8
Description: NF3635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3635_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 242 - 382
Target Start/End: Original strand, 2170032 - 2170172
Alignment:
| Q |
242 |
ctagaagcccaaatttgcagtgcagattcacaactaataatggtaaattttggctacaacagaatcttttcattctcccttgccttcttactttaaataa |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170032 |
ctagaagcccaaatttgcagtgcagattcacaactaataatggtaaattttggctacaacagaatcttttcattctcccttgccttcttactttaaataa |
2170131 |
T |
|
| Q |
342 |
ataataagatgattactactgcttaatacccccagtataat |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2170132 |
ataataagatgattactactgcttaatacccccagtataat |
2170172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 2166456 - 2166589
Alignment:
| Q |
1 |
ggaaggtgaaataatccattgaaattagattatggtcatgaagatgctgatagtatgcacgctcgcactaacttcattttttagggttgcaaactttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2166456 |
ggaaggtgaaataatccattgaaattaaattatggtcatgaagatgctgagagtatgcacgctcgcactaacttcattttttagggttgcaaattttttg |
2166555 |
T |
|
| Q |
101 |
ttttaaaaagttaaattaacctacttagattagt |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
2166556 |
ttttaaaaagttaaattaacctacctagattagt |
2166589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University