View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3636_high_21 (Length: 284)
Name: NF3636_high_21
Description: NF3636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3636_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 14774753 - 14774567
Alignment:
| Q |
1 |
tagaaaaaataagtgctttatattttttgatatcttgtcctattaaaagaaattgctgatatgtgactgaaatgacaatagccattaaaaactcacaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
14774753 |
tagaaaaaataagtgctttatatttttttatatcttgtcctattaaaagaaattgctgatatgtga----aatgacaatagccattgaaaactcacaaat |
14774658 |
T |
|
| Q |
101 |
gcaagtggagaagtcgagatttaaactccgaatcacgacgtttgacctaacaattttgccatttttactagttgagttatga-ttatgaac |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
14774657 |
gcaagtggagaagctgagatttaaactccgagtcaagacgtttgacctaacaattttgccaattttactagttgagttatgacttatgaac |
14774567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 206 - 276
Target Start/End: Complemental strand, 14774583 - 14774513
Alignment:
| Q |
206 |
agttatgacttatgaacttgttctattcaaccttattatctagataaaagtaatttgtctttatgatgatg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
14774583 |
agttatgacttatgaacttgttctattcaactttattacctagataaaagtaacttttctttatgatgatg |
14774513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 184
Target Start/End: Original strand, 10600320 - 10600365
Alignment:
| Q |
139 |
cgtttgacctaacaattttgccatttttactagttgagttatgatt |
184 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
10600320 |
cgtttggcctaacaattttgacatttttattagttgagttaggatt |
10600365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 176
Target Start/End: Original strand, 34271091 - 34271135
Alignment:
| Q |
132 |
atcacgacgtttgacctaacaattttgccatttttactagttgag |
176 |
Q |
| |
|
||||||||||| | ||||||||||| | ||||||||||||||||| |
|
|
| T |
34271091 |
atcacgacgttcggcctaacaatttcgtcatttttactagttgag |
34271135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University