View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3636_high_29 (Length: 250)
Name: NF3636_high_29
Description: NF3636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3636_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 13744378 - 13744612
Alignment:
| Q |
1 |
cttgctttatgttgagcttgtctttatttttgctaatgatttatttgtggaagagctgtgttactctacgaccattgcattatcacatttatgtttttga |
100 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
13744378 |
cttgctttatgttgaactcgtctttatttttgccaatgaattatttgtggaagagctgtgttactttacgaccattgcattaccacatttatgtttttga |
13744477 |
T |
|
| Q |
101 |
tgctgtgctatacatgcacgcacactttgcttcacatctctcaggtttgacctcccatttggtttgaagttgggcattcattacgtcttcacgtttgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
13744478 |
tgctgtgctatacatgcacgcacactttggttcagatctctcaggtttgatctcccatttggtttgaagttgggcattgattatgtcatcacgtttgttg |
13744577 |
T |
|
| Q |
201 |
ttgaataatgtaacatagaccgatacatttactta |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |
|
|
| T |
13744578 |
ttgaataatgtaacatagaccaatacattttctta |
13744612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 52268729 - 52268682
Alignment:
| Q |
17 |
cttgtctttatttttgctaatgatttatttgtggaagagctgtgttac |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52268729 |
cttgtctttatttttgctaatgatttatttgtggaagagctgtgttac |
52268682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University