View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3636_low_36 (Length: 238)
Name: NF3636_low_36
Description: NF3636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3636_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26525719 - 26525496
Alignment:
| Q |
1 |
cccactttgtagttcaatacataaatagcctcatttaacaaacagagtcaacatcaatgttaataagcatacttttgtgaaattttacctccaaaccaga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
26525719 |
cccactttttagttcaatacataaattacctcatttaccaaagagagtcaacatcaatgttaataagcatatttttgtgaaattttacctttaaaccaga |
26525620 |
T |
 |
| Q |
101 |
taacaacttaaagtgtaaaat---aataccttttatggtacaaatattgcaccannnnnnnnnnnnngccaataatcaaagtatcaatggaaaattggaa |
197 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
26525619 |
taacaacttaaaaagtaaaataataataccttttatggtacaaatattgcaccatttttttttttttgccaataatcaaagtatcattggaaaattggaa |
26525520 |
T |
 |
| Q |
198 |
atgagtacctctgaaacatccatc |
221 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
26525519 |
atgagtaactctgaaacatccatc |
26525496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University