View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3636_low_37 (Length: 237)
Name: NF3636_low_37
Description: NF3636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3636_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 36578300 - 36578081
Alignment:
| Q |
1 |
ttttatccataaaaaattatgtaagattaaatactattcaatatcataaaagttatgtattgtttt-accttttatagtgtgttgttatgttaaatattt |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||| ||| ||| |||||||||||||||||| |
|
|
| T |
36578300 |
ttttatccataaaaaattatataagattaaatattattcaatatcataaaagttatgtattgtttttacctt--atactgtattgttatgttaaatattt |
36578203 |
T |
|
| Q |
100 |
actgtccagcagatcaaacatagcgaaagcacttttcaaaggtgtgttcgtgtgggtttgcttgctcatgagtcttgagtgcgctttgcctgcggcttta |
199 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
36578202 |
accgtctagcagatcaaacatagcgaaagcacttttcaaaggtgtgttcgtgtgggtttgcttgctcatgactcatgagtgcgctttgcctgcggcttta |
36578103 |
T |
|
| Q |
200 |
tttagcttttacttaatccaac |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36578102 |
tttagcttttacttaatccaac |
36578081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University