View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3636_low_38 (Length: 231)
Name: NF3636_low_38
Description: NF3636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3636_low_38 |
 |  |
|
| [»] scaffold1391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1391 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold1391
Description:
Target: scaffold1391; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 112 - 333
Alignment:
| Q |
1 |
tccatcaatccgatcagtgatccaattattggtgttgattttaaaacactgatttattctttcttccatgattatatatccagttatttccagttttcaa |
100 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
112 |
tccaccaatccgattagtgatccaattattggtgttgattttaaaacactgatttattctttcttccatgattatatatccggttatttccagttttcaa |
211 |
T |
 |
| Q |
101 |
aattcaatttgttccaaagtcaaatttgacttttggttaattatttactg-nnnnnnnnnnnnccatagttg-caacgcgcacatgccgaaaaacatatg |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
212 |
aattcaatttgttacaaagtcaaatttgacttttggttaattatttactgcaacgaaaaaaaaacatagttgacaacgcgcacatgccgaaaaacatatg |
311 |
T |
 |
| Q |
199 |
taatgcgttatattgtattttt |
220 |
Q |
| |
|
|||||| | |||| |||||||| |
|
|
| T |
312 |
taatgcataatatcgtattttt |
333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University