View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3637_low_3 (Length: 356)
Name: NF3637_low_3
Description: NF3637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3637_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 2903664 - 2903825
Alignment:
| Q |
1 |
tataaaatagataaattaataaaggatttggggttgcccttttaattgttgttcttctacgatctcacgcacgcacgttcccagcttttgcaattctcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2903664 |
tataaaatagataaattaataaaggatttggggttacccttttaattgttgttcttctacgatctcacgcacgcacgttcccagcttttgcaattctcca |
2903763 |
T |
 |
| Q |
101 |
ttccaaccttagctaggtacttttgttttgattgatttctttctcgttaattaattgtcatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2903764 |
ttccaaccttagctaggtacttttgttttgattgatttctttctcgttaattaattgtcatg |
2903825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 2873154 - 2873319
Alignment:
| Q |
1 |
tataaaatagataaattaataaaggatttggggttgcccttttaattgttgttcttctacgatctca----cgcacgcacgttcccagcttttgcaattc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2873154 |
tataaaatagataaattaataaaggatttggggttgcccttttaattgttgttcttctacgatctcactcacgcacgcacgttcccagcttttgcaattc |
2873253 |
T |
 |
| Q |
97 |
tccattccaaccttagctaggtacttttgttttgattgatttctttctcgttaattaattgtcatg |
162 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873254 |
tccattccgaccttagctaggtacttttgttttgattgatttctttctcgttaattaattgtcatg |
2873319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 235 - 342
Target Start/End: Original strand, 2903898 - 2904005
Alignment:
| Q |
235 |
gtgtgatcggccatgaaaagaataaagggttcaattaccccaccaagggctactatccaaagatgcagcaataaagcagaaagtcaacaactttgccctt |
334 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2903898 |
gtgtgatcggccatgaaaagaaaaaagggttcaattaccccaccaagggctactatccaaagatgcagcaataaatcagaaagtcaacaactttgtcctt |
2903997 |
T |
 |
| Q |
335 |
actttgat |
342 |
Q |
| |
|
|||||||| |
|
|
| T |
2903998 |
actttgat |
2904005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 235 - 342
Target Start/End: Original strand, 2873392 - 2873499
Alignment:
| Q |
235 |
gtgtgatcggccatgaaaagaataaagggttcaattaccccaccaagggctactatccaaagatgcagcaataaagcagaaagtcaacaactttgccctt |
334 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
2873392 |
gtgtgatcggccatgaaaagaaaaaagggttcaattaccccaccaagggctactatccaaagatgcagcaataaatcaaaatgtcaacaactttgccctt |
2873491 |
T |
 |
| Q |
335 |
actttgat |
342 |
Q |
| |
|
|||||||| |
|
|
| T |
2873492 |
actttgat |
2873499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University