View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3637_low_5 (Length: 266)
Name: NF3637_low_5
Description: NF3637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3637_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 252
Target Start/End: Complemental strand, 43204316 - 43204099
Alignment:
| Q |
35 |
aaaagcatatatatggagtcgcttgattatttgtgataggaaacatttgttccaagattataacgatggaaaaaacatttaaacaatgtgtnnnnnnnga |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43204316 |
aaaagcatatatatggagtcgcttgattatttgtgataggaaacatttgttccaagattataacgatggaaaaaacatttaaacaatgtgtaaaaaaaga |
43204217 |
T |
 |
| Q |
135 |
gagcatttgagccatatatatctcaattgttggatttaagtgagttctcacattacataagaatccatataaggtatatctaatgtcttaagtggtctta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43204216 |
gagcatttgagccatatatatctcaattgttggatttaagtgagttctcacattacataagaatccatataaggtatatctaatgtctgaagtggtctta |
43204117 |
T |
 |
| Q |
235 |
gagcattgatttgttatt |
252 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43204116 |
gagcattgatttgttatt |
43204099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University