View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3638_high_5 (Length: 303)
Name: NF3638_high_5
Description: NF3638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3638_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 7760602 - 7760410
Alignment:
| Q |
13 |
aacctagatattgtttggctaagaaaagatggaggaagaagacggtttcaggattaaaggaaaatgacatttcatagtaagccagaaccttctgatccct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7760602 |
aacctagatattgtttggctaagaaaagatggaggaagaagacggtttcaggattaaaggaaaatgacatttcatagtaagccagaaccttctgatcctt |
7760503 |
T |
 |
| Q |
113 |
ataaacaaccgcatttgaaattgtccatacgttgcttgtcggtgtaatgataaatcagaaaggtgatgatggacttggttactctgaacttga |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7760502 |
ataaacaaccgcatttgaaattgtccatacgttgcttgtcggtgtaatgataaatcagaaaggtgatgatggacttggttactctgaacttga |
7760410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 246 - 293
Target Start/End: Complemental strand, 7760368 - 7760321
Alignment:
| Q |
246 |
aaaacatattgctgtggaaattgctcgtcttgcaatgttcttcctttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7760368 |
aaaacatattgctgtggaaattgctcatcttgcaatgttcttcctttg |
7760321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 247 - 289
Target Start/End: Complemental strand, 10268870 - 10268828
Alignment:
| Q |
247 |
aaacatattgctgtggaaattgctcgtcttgcaatgttcttcc |
289 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
10268870 |
aaacatattgccgtggaaattgcttgtcttgcaatgttcttcc |
10268828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University