View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_high_53 (Length: 238)
Name: NF3639_high_53
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_high_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 26152846 - 26153064
Alignment:
| Q |
1 |
ccgattggattggtcgtcgttacaccatcgtgtttgcgggggccattttcttcgtcggagccttactcatgggtttctcaccaaactataacttcctcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26152846 |
ccgattggattggtcgtcgttacaccatcgtgtttgcaggggccattttctttgtcggagccttactcatgggtttctcaccaaactacaacttcctcat |
26152945 |
T |
 |
| Q |
101 |
gtttggccgctttgtcgccggagttggcatcggctatgctctcatgattgccccggtctataccgctgaagtctcccccgcttcctctcgcggctttctc |
200 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26152946 |
gtttggtcgttttgttgccggagttggcatcggctatgctctcatgattgccccggtctataccgctgaagtctcccccgcttcctctcgcggctttctc |
26153045 |
T |
 |
| Q |
201 |
acttctttccctgaggtta |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26153046 |
acttctttccctgaggtta |
26153064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 216
Target Start/End: Original strand, 27318946 - 27319117
Alignment:
| Q |
45 |
attttcttcgtcggagccttactcatgggtttctcaccaaactataacttcctcatgtttggccgctttgtcgccggagttggcatcggctatgctctca |
144 |
Q |
| |
|
||||||||||||||||| |||| ||||| | || ||||||||| || ||||||||||| || || | || || |||||||| || | ||| || |
|
|
| T |
27318946 |
attttcttcgtcggagctgtacttatgggactttctccaaactatgcatttctcatgtttggtcgtttctttgctggtgttggcatagggtttgccttct |
27319045 |
T |
 |
| Q |
145 |
tgattgccccggtctataccgctgaagtctcccccgcttcctctcgcggctttctcacttctttccctgagg |
216 |
Q |
| |
|
||||||| || || |||||| ||||||||||||| |||| ||||| ||||| |||||||| || ||||||| |
|
|
| T |
27319046 |
tgattgctcctgtttatacctctgaagtctccccaacttcatctcgtggcttcctcacttccttgcctgagg |
27319117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 217
Target Start/End: Original strand, 54348272 - 54348360
Alignment:
| Q |
129 |
atcggctatgctctcatgattgccccggtctataccgctgaagtctcccccgcttcctctcgcggctttctcacttctttccctgaggt |
217 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||| ||||||||||| ||||||||||||||||| ||||| || ||||| ||||| |
|
|
| T |
54348272 |
atcggctacgctctcatgatcgccccggtctacaccgccgaagtctcccctgcttcctctcgcggcttcctcacctccttccccgaggt |
54348360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University