View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_30 (Length: 316)
Name: NF3639_low_30
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 13 - 299
Target Start/End: Original strand, 27866141 - 27866429
Alignment:
| Q |
13 |
aatataaatatggtaaggattccatatggagtgacaatcaacgcttaannnnnnnnnngttggagatctgggttcgaactctgaac-ttacatatattaa |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27866141 |
aatataaatatgttaaggattccatatggagtgacaatcaacgcttaatttttttgttgttggtgatctgggttcgaactctgaaccttacatatattaa |
27866240 |
T |
 |
| Q |
112 |
gcttacgagaacaacatttaaaaatttgcacacgcaagaagaatttcggccttgaacccaaaaattgcataaaatgtccaacttaataatgtcgacaata |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27866241 |
acttacgaaaacaacatttaaaaatttgcacacgcaagaagaatttcggccttgaacccaaaaattgcataaaatgtccaacttaataatgtcgacaata |
27866340 |
T |
 |
| Q |
212 |
tc-aattcatttgaattattcaaacgataatgtggaattatagtacatactacatacggcgtaggtcaagagctatagctcctaactag |
299 |
Q |
| |
|
|| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27866341 |
tcaaattcagttgaattatttaaacgataatgtggaattatagtacatactacatacggcgttggtcatgagctatagctcctaactag |
27866429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University