View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_40 (Length: 269)
Name: NF3639_low_40
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_40 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 25 - 269
Target Start/End: Original strand, 43187860 - 43188104
Alignment:
| Q |
25 |
ttctgctatttgagtagtttaattgcggtttgagtggtttaaaacaattcaaccatgatccagagatattcttggttcaatgttcagtctttaaaacact |
124 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43187860 |
ttctgttatttgattagtttaattgcggtttgagtgatttaaaacaattcaaccatgatccagagatattcttggttcaatgttcagtctttaaaacact |
43187959 |
T |
|
| Q |
125 |
gcaattaattgaattcatattgtgacctccactgatatctttcaattcatgaagaaaaatggaatggaatacaatgagacgaaatttgagaggatttgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43187960 |
gcaattaattgaattcatattgtgacctccactgatatctttcagttcatgaagaaaaatggaatggaatacaatgagacgaaatttgagaggatttgat |
43188059 |
T |
|
| Q |
225 |
tgtcgaaggtctgtttttctcaacatcatcgttgttacaactaga |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188060 |
tgtcgaaggtctgtttttctcaacatcatcgttgttacaactaga |
43188104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 106 - 149
Target Start/End: Original strand, 22710090 - 22710133
Alignment:
| Q |
106 |
gttcagtctttaaaacactgcaattaattgaattcatattgtga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22710090 |
gttcagtctttaaaacactgcaattaattgaagtcatattgtga |
22710133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University