View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_50 (Length: 247)
Name: NF3639_low_50
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 25809689 - 25809462
Alignment:
| Q |
4 |
ggtttgcctagcatgagcgctgcccctccattgttcaccgttacagcttgcctaattcaattatccaattgcttgtctactgattgtgcttgttgttgat |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25809689 |
ggtttgcctagcatgggcgctgcccctccattgttcaccgttacagcttgcctaattcaattatccaattgcttgtctactgattgtgcttgttgttgat |
25809590 |
T |
 |
| Q |
104 |
tgctctaaggaaaccatttcaattttttaaaacaattcaacaccaatccaattggcttatgtaagttagcaacaacaccaattttttccttgtacttgca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25809589 |
tgctctaaggaaaccatttcaattttttaaaacaattcaacaccaatccaattggcttatgtaagttagcaacaacaccaattttttccttgtacttgca |
25809490 |
T |
 |
| Q |
204 |
aacaaattgtattgggatcacgtgtctg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25809489 |
aacaaattgtattgggatcacgtgtctg |
25809462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 12399376 - 12399156
Alignment:
| Q |
1 |
tagggtttgcctagcatgagcgctgcccctccattgttcaccgttacagcttgcctaattcaattatccaattgcttgtctactgattgtgcttgttgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12399376 |
tagggtttgcctagcatgagcgctgcccctccattattcaccgttacagcttgcttaattcaattatccaattgcttgtctactgattgtgccagttgtt |
12399277 |
T |
 |
| Q |
101 |
gattgctctaaggaaaccatttcaattttttaaaacaattcaacaccaatccaattggcttatgtaagttagcaacaacaccaattttttccttgtactt |
200 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||| || |
|
|
| T |
12399276 |
gattgctctaaagaaaccatttcagttttttacaacaattcaacaccaatccaattggcttacgtaagctagcaacaacaccaatcttttcctt----tt |
12399181 |
T |
 |
| Q |
201 |
gcaaacaaattgtattgggatcacg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
12399180 |
gcaaacaaattgtattgggatcacg |
12399156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University