View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_54 (Length: 245)
Name: NF3639_low_54
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 43186146 - 43186375
Alignment:
| Q |
1 |
taacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataaccactgttgtcgattgcagatcgcggagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186146 |
taacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataaccactgttgtcgattgcagatcgcggagaa |
43186245 |
T |
 |
| Q |
101 |
gagtggtttgcttgaaattggctatgctacgagcta--tacagctgctatttaacaacaatgatgataaaaactgataattttcttcatcataaacacta |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43186246 |
gagtggtttgcttgaaattggctatgctacgagctatgtacagctgctatttaacaacaatgatgattacaactgataattttcttcatcataaacacta |
43186345 |
T |
 |
| Q |
199 |
aaataatcttaaaggatacaccggacctct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43186346 |
aaataatcttaaaggatacaccggacctct |
43186375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University