View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_59 (Length: 239)
Name: NF3639_low_59
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 7951467 - 7951258
Alignment:
| Q |
18 |
atatgccagaaatttattttgtgacttttcttcacataaatatgtactattgtgatttaattttcttcaaacttttctttgactggttaattttgttcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7951467 |
atatgccagaaatttattttgtgacttttcttcacataaatatgtactattgtgatttaattttcttcaaacttctctttgactggttaattttgttcaa |
7951368 |
T |
 |
| Q |
118 |
acataaaagctt---attgcttcttgcatatttctatacatactacataggcacctagatatcttgtgcaaacttatgttaataagggtttttgacctaa |
214 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7951367 |
acataaaagtttgtgattgcttcgtgcatatttctatacatactacataggctcctagatatcttgtgcaaacttatgttaaaaagggtttttgacctaa |
7951268 |
T |
 |
| Q |
215 |
ttgaataagg |
224 |
Q |
| |
|
||| |||||| |
|
|
| T |
7951267 |
ttggataagg |
7951258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University