View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3639_low_61 (Length: 227)
Name: NF3639_low_61
Description: NF3639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3639_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 51035401 - 51035600
Alignment:
| Q |
15 |
aaggcacgtttagaatatttgttcagtcattcattgctagtaatgcttgcgtaagtacccaataggaccgagattcatatcataacataacccccttcta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51035401 |
aaggcacgtttagaatatttgttcagtcattcattgctggtaatgcttgcgtaagtacccaataggaccgagattcatatcataacataacccccttcta |
51035500 |
T |
 |
| Q |
115 |
tacacttttccaacttcatcatatgattccataggcagtctatcataattataaataactgatcgtaaatgagaacattaatcttttaagacattgtttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51035501 |
tacacttttccaacttcatcatatgattccataggcagtctatcataattataaataactgatcgtaaatgagaacattaatcttttaagacattgtttg |
51035600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 98
Target Start/End: Original strand, 51043205 - 51043287
Alignment:
| Q |
15 |
aaggcacgtttagaatatttgttcagtcattcattgctagtaatgcttgcgtaagtacccaataggaccgagattcatatcata |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| | || |||| |||||||||||||| ||| | ||||||||||| |
|
|
| T |
51043205 |
aaggcacgtttagaatatttgtttagtcattcatagctggcaa-acttgaataagtacccaatagcacccatgttcatatcata |
51043287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University