View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_high_34 (Length: 291)
Name: NF3640_high_34
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_high_34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 40819203 - 40818930
Alignment:
| Q |
18 |
aatactaatatttccatgcaatatcaacttcaaaaccctatgatgaaagaaagtcttgtcatgtttggaagcgagggaagttgttgcagttcatctgatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40819203 |
aatactaatatttccatgcaatatcaacttcaaaaccctatgatgaaagaaagtcttgtcatgtttggaagtgagggaagttgttgcagttcatctgatg |
40819104 |
T |
 |
| Q |
118 |
gaagtcttgggaaacaagaagaaataatggggtttcagaatttcatgcaaatcaacaagttcaatcttagtaatggaagtgatgttgttgatgttaacaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
40819103 |
gaagtcttgggaaacaagaagaaataatggggtttcagaatttcatgcaaatcaacaagttcaatcttagtcatggaagtgatgttgttgatgttaataa |
40819004 |
T |
 |
| Q |
218 |
ccaatgggaaagagaaaaggtgaatttatgctttagtcaaagtcatgaaaagcaaattactagtactacacctt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
40819003 |
ccaatgggaaagagaaaaggtgaatttatgctttagtcaaaatcatgaaaagcaaattactagtacgacacctt |
40818930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University