View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_high_40 (Length: 270)
Name: NF3640_high_40
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 25881584 - 25881843
Alignment:
| Q |
1 |
ctccggggagcctgactcccgtgtcgtcggtattggactcgccggaaaaggcctccgtggttatctcccgtcggagctcggaaaccttatctacctccgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25881584 |
ctccggggagcctgactcccgtgtcgtcggtattggactcgccggaaaaggtctccgtggttatctcccgtcggagctcggaaaccttatctacctccgt |
25881683 |
T |
 |
| Q |
101 |
cgtcttagcctccatactaacctcttccatggctccattcccgttcagctcttcaatgctagttcccttcacagcatcttcctccacggaaacaatctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25881684 |
cgtcttagcctccatactaacctcttccatggctccattcccgttcagctcttcaatgctagttcccttcacagcatcttcctccatggaaacaatctct |
25881783 |
T |
 |
| Q |
201 |
ccggtaatctctccccgtcggcgtgtaaccttcctcgtcttcaaaatcttgacctctctg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25881784 |
ccggtaatctctccccgtcggcgtgtaaccttcctcgtcttcaaaatcttgacctctctg |
25881843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University