View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_high_59 (Length: 230)
Name: NF3640_high_59
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 222
Target Start/End: Original strand, 1609056 - 1609254
Alignment:
| Q |
24 |
atcatgagtttaatcactacgtaaggttaagcctaactcccatgnnnnnnnngcattcaacaattatagtaaggtgcaaaacattttcaaaaaggatatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1609056 |
atcatgagtttaatcactacgtaaggttaagcctaactcccatgttttttttgcattcaacaattatagtaaggtgcaaaacattttcaaaaaggatatt |
1609155 |
T |
 |
| Q |
124 |
aaaactgaagctaatgagagatccattcaatagtaattggtttggaatttcaagacttgaaaagatattaaattagtatgcttttggcctttaggatat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1609156 |
aaaactgaagctaatgagagatccattcaatagtaattggtttggaatttcaagacttaaaaagatattaaattagtatgcttttgacctttaggatat |
1609254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University