View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_low_47 (Length: 256)
Name: NF3640_low_47
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_low_47 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 1608422 - 1608660
Alignment:
| Q |
18 |
agataaactgtcaatgcaaagaacaggagaagtttaacatttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608422 |
agataaactgtcaatgcaaagaacaggagaagtttaacttttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
1608521 |
T |
|
| Q |
118 |
atcttgagtagtaaagaaaatacatttgtgacaaacatacatgtctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcgc |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1608522 |
attttgagtagtaaagaaaatacatttgtgacaaacatacatgcctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcac |
1608621 |
T |
|
| Q |
218 |
aaactatcataagcaaaatgagctaaaatgttgaacctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608622 |
aaactatcataagcaaaatgagctaaaatgttgaacctt |
1608660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University