View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_low_55 (Length: 244)
Name: NF3640_low_55
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 44247637 - 44247845
Alignment:
| Q |
1 |
tttttaatttgtctatcatgtcctgatttaatttcaannnnnnnaatgtcatgatttatgatttatatcttgtcctcgtgtaannnnnnngtctatcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44247637 |
tttttaatttgtctatcatgtcctgatttaatttcaatttttttaatgtcatgatttatgatttatatcttgtcctcgtgtaatttgtttgtctatcaaa |
44247736 |
T |
|
| Q |
101 |
cactaatggtatctgccaatttctttttgtaaaaactttaaattaagaagcaaaaatttgttctcataataaatatatcaatgtatgatataatgtaaac |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44247737 |
cactaatggtatctgcca-tttctttttgtaaaaactttaaattaagaagcaaaaatttgttctcataataaatatatcaatgtatgatataatgtaaac |
44247835 |
T |
|
| Q |
201 |
aatatacttc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
44247836 |
aatatacttc |
44247845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University